Multilocus phylogenetics in a widespread African anuran lineage (Brevicipitidae: Breviceps) reveals patterns of diversity reflecting geoclimatic change

AimTo investigate models assessing the influence of geomorphology and climatic shifts on species diversification in sub‐Saharan Africa by reconstructing the pattern and timing of phylogenetic relationships of rain frogs (Brevicipitidae: Breviceps).LocationSub‐Saharan Africa, south of the Congo Basin.MethodsMultilocus sequence data were generated for near complete species‐level sampling of the genus Breviceps. Phylogenetic relationships were inferred via Bayesian inference and maximum likelihood analyses on both concatenated and single‐gene datasets. Network analyses identified locus‐specific reticulate relationships among taxa. Bayesian methods were used to infer dates of divergence among Breviceps lineages, and niche modelling was used to identify possible adaptive divergence.ResultsBreviceps is monophyletic and comprised of two major, largely allopatric subclades. Diversity within each subclade is concentrated in two areas with contrasting geologic and climatic histories: the arid/semiarid winter rainfall zone in the south‐western (SW) Cape, and the semitropical East Coast that receives predominantly summer rainfall. Recognized species diversity in the SW Cape based on phenotypic variation is consistent with observed genetic patterns whereas the East Coast is shown to harbour unexpectedly high genetic diversity and up to seven putative, cryptic species. Niche models show significant overlap between closely related species.Main conclusionsDating analyses indicate that diversification of Breviceps occurred rapidly within the Miocene, with only a moderate decline over the Plio‐Pleistocene, suggesting that this process might be slowed but ongoing. Our findings suggest that a combination of two models, a landscape barrier model and climate fluctuation model, can explain patterns of diversification in Breviceps. This demonstrates that Miocene epeirogenic events and climatic shifts may have had a considerable influence on contemporary patterns of biodiversity. Topographic complexity and relative geoclimatic stability in the East have promoted cryptic diversification in allopatry, and this area clearly harbours numerous undescribed taxa and is in need of detailed biotic investigation.Peer Reviewedhttps://deepblue.lib.umich.edu/bitstream/2027.42/145569/1/jbi13394.pdfhttps://deepblue.lib.umich.edu/bitstream/2027.42/145569/2/jbi13394_am.pd

Cancer evolution: mathematical models and computational inference.

Cancer is a somatic evolutionary process characterized by the accumulation of mutations, which contribute to tumor growth, clinical progression, immune escape, and drug resistance development. Evolutionary theory can be used to analyze the dynamics of tumor cell populations and to make inference about the evolutionary history of a tumor from molecular data. We review recent approaches to modeling the evolution of cancer, including population dynamics models of tumor initiation and progression, phylogenetic methods to model the evolutionary relationship between tumor subclones, and probabilistic graphical models to describe dependencies among mutations. Evolutionary modeling helps to understand how tumors arise and will also play an increasingly important prognostic role in predicting disease progression and the outcome of medical interventions, such as targeted therapy.FM would like to acknowledge the support of The University of Cambridge, Cancer Research UK and Hutchison Whampoa Limited.This is the final published version. It first appeared at http://sysbio.oxfordjournals.org/content/early/2014/10/07/sysbio.syu081.short?rss=1

Cryptic diversity among Yazoo Darters (Percidae: Etheostoma raneyi) in disjunct watersheds of northern Mississippi

© Copyright 2020 Nasser et al. The Yazoo Darter, Etheostoma raneyi (Percidae), is an imperiled freshwater fish species endemic to tributaries of the Yocona and Little Tallahatchie rivers of the upper Yazoo River basin, in northern Mississippi, USA. The two populations are allopatric, isolated by unsuitable lowland habitat between the two river drainages. Relevant literature suggests that populations in the Yocona River represent an undescribed species, but a lack of data prevents a thorough evaluation of possible diversity throughout the range of the species. Our goals were to estimate phylogenetic relationships of the Yazoo Darter across its distribution and identify cryptic diversity for conservation management purposes. Maximum likelihood (ML) phylogenetic analyses of the mitochondrial cytochrome b (cytb) gene returned two reciprocally monophyletic clades representing the two river drainages with high support. Bayesian analysis of cytb was consistent with the ML analysis but with low support for the Yocona River clade. Analyses of the nuclear S7 gene yielded unresolved relationships among individuals in the Little Tallahatchie River drainage with mostly low support, but returned a monophyletic clade for individuals from the Yocona River drainage with high support. No haplotypes were shared between the drainages for either gene. Additional cryptic diversity within the two drainages was not indicated. Estimated divergence between Yazoo Darters in the two drainages occurred during the Pleistocene (\u3c1 million years ago) and was likely linked to repeated spatial shifts in suitable habitat and changes in watershed configurations during glacial cycles. Individuals from the Yocona River drainage had lower genetic diversity consistent with the literature. Our results indicate that Yazoo Darters in the Yocona River drainage are genetically distinct and that there is support for recognizing Yazoo Darter populations in the Yocona River drainage as a new species under the unified species concept

A new genus of Cophomantini, with comments on the taxonomic status of Boana liliae (Anura: Hylidae)

© 2018 The Linnean Society of London The non-monophyly of both the genus Myersiohyla and the Boana punctata group has been recovered in a number of published phylogenetic analyses. In this paper we report on the analysis of sequences of Boana liliae, a species originally assigned to the B. punctata group, in a dataset of Cophomantini that recovered novel phylogenetic relationships for this hylid tribe. Our results reveal Myersiohyla to be paraphyletic with respect to B. liliae. Support for the placement of Myersiohyla kanaima is poor, but this taxon is recovered as the sister taxon of the other Cophomantini genera (excluding Myersiohyla) or as the sister taxon of the remaining species of Myersiohyla (including B. liliae). These results lead us to propose two taxonomic changes in order to remedy the paraphyly of Myersiohyla: (1) a new genus is described for M. kanaima, and (2) Boana liliae is transferred to Myersiohyla. We further provide notes on the natural history and vocalizations of the new monotypic genus, a new diagnosis of the former B. liliae in the context of Myersiohyla, and discuss the evolution of tadpole morphology and biogeography of the earlier diverging clades of Cophomantini

Development of 10 microsatellite loci in the wolf spider Arctosa sancterosae (Araneae: Lycosidae)

Abstract Ten novel microsatellite loci were isolated from Arctosa sancterosae, a white dune dwelling species of wolf spider. Diversity was assessed in 273 individuals sampled from 11 populations along the Northern coast of the Gulf of Mexico. These new genetic markers will be useful for the description and conservation of these limited populations. Keywords Arachnids Á Coastal dune ecosystem Á Microsatellites Á Enriched library The white beach spider, Arctosa sancterosae, is a burrowing wolf spider endemic to the dune ecosystem of the northern coast of the Gulf of Mexico (NGC). Species endemic to this ecosystem are ideal for examining the effects of disturbance (e.g. hurricanes, habitat fragmentation/degradation) on population persistence. It is widely recognized that the primary threat to these populations is habitat fragmentation, but with the reduced gene flow associated with anthropogenic habitat modification and a predicted increase in the intensity of tropical storms We developed 10 novel microsatellite loci using the enrichment protocol of Glenn and Schable 2005. Whole genomic DNA was extracted from the legs of A. sancterosae using the DNeasy Tissue Kit (Qiagen) according to the manufacturer's instructions. DNA concentration was determined using a spectrophotometer and genomic DNA was then digested with the restriction enzymes RsaI and XmnI to yield fragments between 300 and 1,000 bp long. To the ends of these fragments we then ligated SuperSNX24 linkers (F; GTTTAAGG CCTAGCTAGCAGAATC, R; GATTCT GCTAGCTAGGCCTTAAACAAAA) and a polymerase chain reaction was performed to ensure ligation was successful. Genomic fragments were enriched using a probe mix containing four biotinylated oligonucleotides (AAT 10 , AAAT 7 , AAC 6 and AGAT 8 ) and separated with streptavidin magnetic beads. This mixture was washed with a 29 SSC, 0.1% SDS solution twice and a 19 SSC, 0.1% SDS solution four times. A magnetic particle collector was used between washes to capture the magnetic beads. After the last wash, fragments were removed from the probes by denaturing at 95°C for 5 min and precipitating with 95% ethanol and 3 M sodium acetate. These fragments were then air-dried and resuspended in 25 lL of TLE. To increase the quantity of these recovered enriched DNA we amplified the enriched pool by PCR using the SuperSNX24-F primer. These amplified fragments were then transformed and cloned using a TOPO TA Cloning Kit (45-0641). Blue-white selection revealed 288 clones that were then screened for inserts suitable (large enough) for microsatellite development by PCR using M13 forward and reverse primer

Weak warning signals can persist in the absence of gene flow

Aposematic organisms couple conspicuous warning signals with a secondary defense to deter predators from attacking. Novel signals of aposematic prey are expected to be selected against due to positive frequency-dependent selection. How, then, can novel phenotypes persist after they arise, and why do so many aposematic species exhibit intrapopulation signal variability? Using a polytypic poison frog (Dendrobates tinctorius), we explored the forces of selection on variable aposematic signals using 2 phenotypically distinct (white, yellow) populations. Contrary to expectations, local phenotype was not always better protected compared to novel phenotypes in either population; in the white population, the novel phenotype evoked greater avoidance in natural predators. Despite having a lower quantity of alkaloids, the skin extracts from yellow frogs provoked higher aversive reactions by birds than white frogs in the laboratory, although both populations differed from controls. Similarly, predators learned to avoid the yellow signal faster than the white signal, and generalized their learned avoidance of yellow but not white. We propose that signals that are easily learned and broadly generalized can protect rare, novel signals, and weak warning signals (i.e., signals with poor efficacy and/or poor defense) can persist when gene flow among populations, as in this case, is limited. This provides a mechanism for the persistence of intrapopulation aposematic variation, a likely precursor to polytypism and driver of speciation

An ancient adaptive episode of convergent molecular evolution confounds phylogenetic inference

Convergence can mislead phylogenetic inference by mimicking shared ancestry, but has been detected only rarely in molecular evolution. Here, we show that significant convergence occurred in snake and agamid lizard mitochondrial genomes. Most evidence, and most of the mitochondrial genome, supports one phylogenetic tree, but a subset of mostly amino acid-altering mitochondrial sites strongly support a radically different phylogeny. These sites are convergent, probably selected, and overwhelm the signal from other sites. This suggests that convergent molecular evolution can seriously mislead phylogenetics, even with large data sets. Radical phylogenies inconsistent with previous evidence should be treated cautiously

Phylogenomics Reveals Ancient Gene Tree Discordance in the Amphibian Tree of Life

The Author(s) 2020. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. Molecular phylogenies have yielded strong support for many parts of the amphibian Tree of Life, but poor support for the resolution of deeper nodes, including relationships among families and orders. To clarify these relationships, we provide a phylogenomic perspective on amphibian relationships by developing a taxon-specific Anchored Hybrid Enrichment protocol targeting hundreds of conserved exons which are effective across the class. After obtaining data from 220 loci for 286 species (representing 94% of the families and 44% of the genera), we estimate a phylogeny for extant amphibians and identify gene tree-species tree conflict across the deepest branches of the amphibian phylogeny. We perform locus-by-locus genealogical interrogation of alternative topological hypotheses for amphibian monophyly, focusing on interordinal relationships. We find that phylogenetic signal deep in the amphibian phylogeny varies greatly across loci in a manner that is consistent with incomplete lineage sorting in the ancestral lineage of extant amphibians. Our results overwhelmingly support amphibian monophyly and a sister relationship between frogs and salamanders, consistent with the Batrachia hypothesis. Species tree analyses converge on a small set of topological hypotheses for the relationships among extant amphibian families. These results clarify several contentious portions of the amphibian Tree of Life, which in conjunction with a set of vetted fossil calibrations, support a surprisingly younger timescale for crown and ordinal amphibian diversification than previously reported. More broadly, our study provides insight into the sources, magnitudes, and heterogeneity of support across loci in phylogenomic data sets.[AIC; Amphibia; Batrachia; Phylogeny; gene tree-species tree discordance; genomics; information theory.].This work was supported by grants from a graduate student research award from the Society of Systematic Biologists and the University of Kentucky G.F. Ribble Endowment (to P.M.H.), by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES/BEX 2806/09-6 to P.L.V.P.), and by the National Science Foundation (DEB-0949532 and DEB-1355000 to D.W.W., DEB-1120516 to E.M.L., IIP-1313554 to A.R.L. and E.M.L, DEB-1355071 to J.M.B., DEB-1441719 to R.A.P., DEB-1311442 to P.L.V.P., DEB-1354506 to R.C.T., DEB-1021247 to E.P. and C.J.R., DEB-1021299 to K.M. Kjer, and DEB-1257610, DEB-0641023, DEB-0423286, and DEB-9984496 to C.J.R.), and the Australian Research Council (DP120104146 to J.S.K. and S.C.D.). S.R.R. thanks SENESCYT (Arca de Noé Initiative; SRR and O. Torres-Carvajal principal investigators) for funding for tissue collection. J.L. was supported by the Systematics Association and the Linnean Society Systematics Research Fund. This material is based upon work supported by the National Science Foundation Graduate Research Fellowship Program (DGE-3048109801 to P.M.H.) and by the National Science Foundation-supported National Center for Supercomputing Applications Blue Waters Graduate Research Fellowship Program (under Grant No. 0725070, subaward 15836, to P.M.H.). Any opinions, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science Foundation

Phylogenomics Reveals Ancient Gene Tree Discordance in the Amphibian Tree of Life

Molecular phylogenies have yielded strong support for many parts of the amphibian Tree of Life, but poor support for the resolution of deeper nodes, including relationships among families and orders. To clarify these relationships, we provide a phylogenomic perspective on amphibian relationships by developing a taxon-specific Anchored Hybrid Enrichment protocol targeting hundreds of conserved exons which are effective across the class. After obtaining data from 220 loci for 286 species (representing 94% of the families and 44% of the genera), we estimate a phylogeny for extant amphibians and identify gene tree–species tree conflict across the deepest branches of the amphibian phylogeny. We perform locus-by-locus genealogical interrogation of alternative topological hypotheses for amphibian monophyly, focusing on interordinal relationships. We find that phylogenetic signal deep in the amphibian phylogeny varies greatly across loci in a manner that is consistent with incomplete lineage sorting in the ancestral lineage of extant amphibians. Our results overwhelmingly support amphibian monophyly and a sister relationship between frogs and salamanders, consistent with the Batrachia hypothesis. Species tree analyses converge on a small set of topological hypotheses for the relationships among extant amphibian families. These results clarify several contentious portions of the amphibian Tree of Life, which in conjunction with a set of vetted fossil calibrations, support a surprisingly younger timescale for crown and ordinal amphibian diversification than previously reported. More broadly, our study provides insight into the sources, magnitudes, and heterogeneity of support across loci in phylogenomic data sets